INTELLIGENT DESIGN struggles. It struggles to identify designed artifacts. It struggles to break away from its existence as a simple attack on Evolution. It struggles to be a science. Despite the bravado in the words of assurance from various ID proponents, none of those struggles have been successful. This is somewhat surprising. What is surprising is not the utter failure of ID as a science but the manner in which that failure has transpired.
ID has failed while riding on the back of an increasingly important field of science – information theory. Information theory, just like a number of other fields such as complex systems and chaos, is finding itself being successfully applied to an ever expanding range of sciences. It is even being applied to biological systems where understanding of the interactions of DNA is enhanced through the use information as an abstract concept. Even with this success, ID can do nothing but reify the concept by making the claim that speciation cannot occur without additional information. The assumption is that information can not be increased but can only be decreased by mutations, preventing novel features from appearing. Without new ‘novel’ features, they claim that body types are restricted to minor modifications of existing phenotypes.
There are a lot of errors in this one assumption, the first of which is the use of the term species. The IDists/Creationists who complain about a ‘lack’ of information necessary by a species to species transit are actually complaining about a morphological change at a level higher than species. Roughly speaking speciation is the termination (or approximate termination) of gene flow between two subspecies. In this case speciation has been observed to take place and does not require an addition to ‘information’ but a ‘change’ whether that change is an insertion, a deletion or a modification. It is at this level all change takes place; the ‘saltation’ events required by the ID/Cr’s seldom, if ever, occur (depending on your definition of saltation).
Another problem with the ‘information’ argument is in the definition of ‘information’ as it applies to biology. If you attempt to apply either Shannon or Kolmogorov-Chaitin information theory to the genome new information can be acquired rather easily by simply changing a nucleotide (more ‘surprise’ and more questions in Shannon, larger string description in K-C). However strictly applying either information theory to the genome is an error because the genome is not simply a string with each nucleotide representing a single character. In fact, if compared to the K-C theory, the genome is more like the algorithm and its data than the string being compressed.
In the K-C approach, the length of the string is less important than the ability to express the same string as an algorithm and its data. In simple terms, the string ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT can be expressed as the algorithm ‘repeat ACGT 15 times’. If you shift gears a bit, think biology, and consider the symmetry of an organism, the 8 legs of an Octopus, the 100 segments of a millipede, or the left/right, two leg, two arm structure of a human, it becomes easy to see the possibility of an algorithm (or a set of instructions on how to build an organism), producing a much more complex organism than is the algorithm itself.
Just as an algorithm can produce a large amount of data, especially when the same algorithm is fed varying inputs, the genome can produce a complex organism. In many cases all that is necessary to produce a novel feature in an organism is to slightly change the inputs to the ‘algorithm’, change the placement of the ‘algorithm’ or duplicate the ‘algorithm’ and slightly modify the steps.
In the case of the genome, since everything in an organism is chemical in nature and genes are triggered and regulated by the type and amount of specific chemicals, (which incidentally make the inputs analog rather than digital) the inputs may be varied to an almost infinite degree. Such changes to a regulatory DNA segment can produce new morphological features. An example would be additional segments in a millipede or the number of vertebrae in a chordate.
In lab experiments organisms such as fruit flies have grown appendages such as antenna and legs in different parts of the body than normal by having a gene for an antenna (or leg) placed in a gene for some other body part. In real life, ‘jumping’ genes called transposons can place themselves almost anywhere in the genome. If they place themselves in a coding section they can duplicate an existing feature or produce novel features
Gene duplication followed by an indel can create a modified version of a feature. An example of this is the 125 million year old gene duplication event in the common ancestor of Arabidopsis thaliana (mustard plant) and the Antirrhinum majus (snapdragon) in which the AG gene in the A. thaliana and the PLE gene in the A. majus have both diverged from the copy and each other.
(For an example of an interesting DNA change check out the parietal eye. http://en.wikipedia.org/wiki/Parietal_eye)
In any case, since all features are built upon pre-existing features and result from modification, sometimes of the existing feature, sometimes of a duplicate, additional ‘information’ as required by the ID/Creation group is not necessary. In cases where additions to the genome are required, duplication of something as minor as a nucleotide or as major as an entire chromosome have been documented.
Even when applying an established science, Intelligent Design cannot get beyond its own ignorance, and thus dooms itself to inevitable failure.
I’d never heard of parietal eyes. Cool!
Tuataras would make a good thread on some site someday as well!
Is the parietal eye actually produced by the eye genes?
I do believe that the particular gene(s) responsible for a parietal eye is unknown. It wasn’t my intention to claim that the eye was a result of a gene copy and mutation of one of the genes resposible for the eye. It was simply intended as an example of a novel feature resulting from a simple change in DNA.
I have made a change that fixes the problem.
>>I do believe that the particular gene(s) responsible for a parietal eye is unknown… I have made a change that fixes the problem.
My previous post got terminated with the quoted section. Meant to add, “Damn! You’re good!”
(Still uncovering undocumented features (AKA bugs) of this forum software.)
no high-falutin’ comments here – this essay simply kicks ass.